GENE THERAPY TOOLS EFFECTIVE FOR JUMPING DYSTROPHINE EXON 53

专利摘要:
The present invention provides a recombinant adeno-associated viral vector (AAVr) comprising a sequence encoding an antisense oligonucleotide (AON) directed against a segment of at least 33 bases of the +30 to +69 region of exon 53 of the present invention. Pre-messenger RNA (pre-mRNA) of dystrophin, advantageously of human origin, as well as its use as a drug, in particular for treating Duchenne muscular dystrophy (DMD).
公开号:FR3044926A1
申请号:FR1562036
申请日:2015-12-09
公开日:2017-06-16
发明作者:France Pietri-Rouxel；Virginie Francois
申请人:Genethon；
IPC主号:

专利说明:

OTTTTLS DF, GENE THERAPY EFFECTIVE FOR JUMPING DYSTROPHINE EXON 53
TECHNICAL AREA
The present invention relates to gene therapy tools particularly effective in the treatment of muscular dystrophic diseases such as Duchenne muscular dystrophy (DMD).
This is based on the judicious choice of antisense oligonucleotide (AON) allowing the jump of the exon 53 of the dystrophin gene, carried by a recombinant adeno-associated viral vector (AAVr), and advantageously associated with a modified snRNA.
PRIOR STATE OF THE TECHNIQUE
Duchenne muscular dystrophy (DMD) is the most common degenerative progressive muscle disease. It is a genetic disease carried by the X chromosome that affects about 1 boy out of 5,000. It results from mutations or deletions in the dystrophin gene. The non-expression or the expression of a very abnormal dystrophin generates a fragility of the muscular fiber, resulting in an accelerated destruction of the muscular tissue. Functional dystrophin deficiency causes fiber degeneration, inflammation, necrosis, and muscle replacement with adipose tissue, resulting in progressive muscle weakness and premature death due to respiratory or cardiac impairment during the second to fourth trimester. decades of life (Moser, H., Hum Genet, 1984. 66 (1): 17-40).
The dmd gene (2.7 Mb), coding for the dystrophin protein, is composed of 79 exons and is located at locus 21.2 of the X chromosome. Dystrophin is a modular protein with a central region composed of 24 spectrin-type repeat domains. -like ".
The majority of the serious mutations of the dystrophin gene consist of deletions of one or more exons disturbing the reading frame of the final messenger, duplications of a portion of the gene, or point mutations present in the coding regions ( or exons), which introduce stop codons or shifts in the read phase.
However, it has been noticed that truncated forms of dystrophin, in particular devoid of certain repeated sequences, are perfectly functional or at least only partially defective, as for example in the attenuated form of the disease called Becker muscular dystrophy (DMB). .
Starting from this observation, and in an alternative way to conventional gene therapy consisting in providing an intact copy of the defective gene (which is problematic in view of the size of that encoding dystrophin), various strategies have been envisaged to attempt to "repair" dysfunctional dystrophins.
Thus, the "exon skipping" ("exon skipping" in English) is a therapeutic approach which consists in administering antisense oligonucleotides (AON) complementary to the sequences involved in the splicing of the exons to be masked, in order to restore the framework of reading. In particular, jumps of exons involved in regions of repeated sequences make it possible to obtain a dystrophin protein shorter than the native protein, but which is nonetheless functional.
In practice, the jump of exon 53 can prove to be beneficial in all the cases where it makes it possible to restore the frame of reading. This theoretically aims at a large number of mutations that may be present in the dystrophin gene, in particular deletions of exon 52 (Δ52), exons 50 to 52 (Δ50-52), exons 49 to 52 (Δ49-52). ), exons 48 to 52 (Δ48-52), exons 47 to 52 (Δ47-52), exons 45 to 52 (Δ45-52), exons 43 to 52 (Δ43-52), exons 42 to 52 (Δ42-52), exons 41 to 52 (Δ41-52), exons 40 to 52 (Δ40-52), exons 39 to 52 (Δ39-52), exons 38 to 52 (Δ38-52) , exons 37 to 52 (Δ37-52), exons 36 to 52 (Δ36-52), exons 35 to 52 (Δ35-52), exons 34 to 52 (Δ34-52), exons 33 to 52 (Δ33-52), exons 32 to 52 (Δ32-52), exons 31 to 52 (Δ31-52), exons 30 to 52 (Δ30-52), exons 29 to 52 (Δ29-52), exons 28 to 52 (Δ28-52), exons 27 to 52 (Δ27-52), exons 26 to 52 (Δ26-52), exons 25 to 52 (Δ25-52), exons 24 to 52 ( Δ24-52), exons 23 to 52 (Δ23-52), exons 21 to 52 (Δ21-52) and exons 10 to 52 (Δ1 0-52), or the duplication of exon 53.
Thus, this strategy makes it possible in particular to consider treating different forms of identified DMDs, in particular those associated with deletions of exon 52 (Δ52), exons 50 to 52 (Δ50-52), exons 49 to 52 ( Δ49-52), exons 48 to 52 (Δ48-52), exons 47 to 52 (Δ47-52), exons 46 to 52 (Δ46-52), exons 45 to 52 (Δ45-52), exons 43 to 52 (Δ43-52) and exons 10 to 52 (Δ10-52), or to a duplication of exon 53.
One of the challenges of this technology is to stably and sustainably introduce an antisense oligonucleotide into diseased muscle fibers.
It has been envisaged to directly inject said NOAs, in bare form. However, in view of the short life of these oligonucleotides in muscle, this method of treatment requires regular injections, relatively restrictive. Developments have been made to chemically modify these oligonucleotides (morpholinos, 2-methyl, inosine derivatives, etc.). This approach makes it possible to stabilize them in vivo, and thus to improve their effectiveness and to space their injection. However, at high doses, this type of oligonucleotide can be toxic.
Alternatively, it has been attempted to express these sequences in situ via expression vectors allowing them to be transported in the target cells. Adeno-associated recombinant viral vectors (or rAAVs) have been shown to be particularly suitable for transduction in muscles. These vectors allow the in vivo transfer of an expression cassette carrying the 1 cod coding sequence and leading to the continuous synthesis of this AON in vivo. Thus, the injection of these vectors has the advantage of allowing a restoration of the expression of the protein in the long term. For example, Le Guiner et al. (Molecular Therapy, 2014, 22 (11) 1923-35) reported significant efficacy of exon skipping coupled with the use of recombinant AAV8, even 3.5 months after locoregional dystrophic dogs.
In this context, the use of sequences derived from snRNA (for "small nucleotide RNA") in these vectors, in which the antisense sequences are inserted, has made it possible to limit the degradation of the AONs in vivo, increasing all the more the effectiveness of treatments over time. This strategy has notably been described in the application WO 2006/021724, reporting the use of U7-type snRNA (U7snRNA) for transporting AONs targeting the dystrophin gene.
The characteristics of snRNAs make them powerful tools for the stable and nuclear expression of AON sequences. Indeed, the corresponding genes are small, expressed stably and continuously at the nuclear level and target the early stages of transcription (pre-mRNA). In practice and in connection with the U7snRNA, it is a question of inserting the AON sequences at the Sm protein binding sites of the snRNAs, so that they no longer target the premonitory RNAs of the histones but the exon of the targeted gene of interest, thus blocking the consensus sites of splicing and making it possible to correct or modify the maturation of this gene.
It has, on the other hand, been suggested to add, to these snRNA sequences, so-called "exon splicing enhancer" sequences, such as, for example, sequences allowing the binding of factors involved in splicing (in particular the hnRNPAl protein, for "heterogeneous ribonucleoprotein A1"), in order to further improve the observed therapeutic effects (Goyenvalle et al., Mol Ther., 17 (7): 1234-1240, 2009).
However, the choice of AONs, and therefore the sequences encoding these AONs in the case of vectors, is critical and has proved particularly complex. Indeed, it is difficult to predict which sequence will be effective. According to the targeted exons, the effective sequences seem to vary and do not concern the same sites. This phenomenon makes the choice of AON sequences particularly delicate and laborious, even using complex algorithms (Echigoya et al., Plos One, March 27, 2015, DOI: 10.1371 / journal.pone.0120058).
Thus, and in connection with exon 53, many antisense have been proposed, varying both in the region of the targeted exon and in the size of the oligonucleotide in question. For example, candidate antisense sequences have been proposed in the following documents: WO2004 / 083446, WO2006 / 000057, US2010 / 0168212, WO2011 / 057350, WO2012 / 029986, WO2014 / 100714, Popelwell et al. (Mol Ther., 2009 Mar; 17 (3): 554-61; Neuromuscul Disord, 2010 Feb; 20 (2): 102-10). A variable efficiency of these sequences, tested in the form of naked or possibly modified oligonucleotides, possibly in combination, has been described in these documents.
In view of the clinical issues, there is still the need to develop an optimized tool for the jump of exon 53 on messenger RNA encoding dystrophin, that is to say, allowing an effective jump of said exon and a high level of expression of the corresponding protein, truncated but potentially functional.
OBJECT OF THE INVENTION
The present invention aims to treat or improve forms of Duchenne Muscular Dystrophy (DMD), in which the jump of exon 53 on messenger RNA encoding dystrophin provides a truncated protein but at the less partially functional.
The proposed solution is based on antisense oligonucleotides (AON) judiciously chosen, both in the region of the exon it targets, and their size. The corresponding sequences are introduced into an efficient expression system consisting of an adeno-associated recombinant viral vector (AAVr) advantageously comprising a snRNA, preferably of U7 type advantageously modified at the Sm protein binding site.
Such vectorized antisense oligonucleotides have made it possible to obtain an efficiency, both in terms of the expression of transcripts devoid of exon 53 and of the production of truncated dystrophin, which has never before been known to the Applicant and therefore constitutes a tool very promising clinic. Definitions
The definitions below correspond to the meaning generally used in the context of the invention and are to be taken into account, unless another definition is explicitly indicated.
Within the meaning of the invention, the articles "a" and "an" are used to refer to one or more (for example at least one) units of the grammatical object of the article. For example, "an element" refers to at least one element, that is, one or more elements.
The terms "approximately" or "approximately", used with reference to a measurable value such as quantity, duration, and other similar values, shall be understood to include measurement uncertainties of ± 20% or ± 10%, preferably ± 5%, still more preferably ± 1%, and particularly preferably ± 0.1% of the specified value.
Intervals: Throughout the present description, the various features of the invention may be presented as a range of values. It should be understood that the description of values in the form of an interval is only intended to make the reading simpler and should not be interpreted as a rigid limitation of the scope of the invention. Accordingly, the description of a range of values should be considered as specifically disclosing all possible intermediate ranges as well as each of the values within that range. For example, the description of a range from 1 to 6 should be considered as specifically describing each of the ranges they comprise, such as ranges from 1 to 3, 1 to 4, 1 to 5, 2 to 4, from 2 to 6, from 3 to 6, etc., as well as each of the values in this range, for example, 1, 2, 2,7, 3, 4, 5, 5,3 and 6. is worth regardless of the range of the interval.
The term "isolated" should be understood in the context of the invention as synonymous with removed or extracted from its environment or natural state. For example, an isolated nucleic acid or peptide is a nucleic acid or a peptide extracted from the natural environment in which it is usually found, whether it is a plant or a live animal, for example. Thus, a nucleic acid or a peptide naturally present in a living animal is not a nucleic acid or an isolated peptide within the meaning of the invention, whereas the same nucleic acid or peptide, partially or completely separated from the other elements present in its natural context is "isolated" within the meaning of the invention. An isolated nucleic acid or peptide may exist in a substantially purified form, or may exist in a non-native environment such as, for example, a host cell.
In the context of the invention, the following abbreviations are used for the most common nucleic acid bases. "A" refers to adenosine, "C" refers to cytosine, "G" refers to guanosine, "T" refers to thymidine, and "U" refers to uridine.
Unless otherwise indicated, within the meaning of the invention, a "nucleotide sequence encoding an amino acid sequence" refers to all the nucleotide sequences that encode the amino acid sequence, including degenerate nucleotide sequences allowing for obtain said amino acid sequence. The nucleotide sequence that encodes a protein or RNA or cDNA may optionally include introns.
The terms "coding" or "coding for", "code" or "code for" refer to the property inherent in the specific nucleotide sequences in a polynucleotide, such as a gene, cDNA or mRNA, to serve as a template. for the synthesis of other polymers and macromolecules in biological processes, having either a defined sequence of nucleotides (eg, rRNA, tRNA and mRNA), or a defined sequence of amino acids, and the resulting biological properties . Thus, a gene encodes a protein if the transcription and translation of the mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, whose nucleotide sequence is identical to the mRNA sequence and which is generally described in the sequence and database listings, the non-coding strand, used as a template for the transcription of a gene or cDNA, may be referred to as coding for the protein or other product of that gene or cDNA.
The term "polynucleotide" as used in the context of the invention is defined as a chain of nucleotides. In addition, the nucleic acids are nucleotide polymers. Thus, the terms nucleic acids and polynucleotides as used in the context of the invention are interchangeable. It is well known in the field of molecular biology and genetic engineering that nucleic acids are polynucleotides, which can be hydrolyzed to monomers. Nucleotides in monomeric form can be hydrolyzed to nucleosides. As used in the context of the invention, the term polynucleotide refers, without limitation, to any type of nucleic acid molecule, that is to say nucleic acid molecules obtainable by any means available in the art, including by recombinant means, namely the cloning of nucleic acid sequences from a recombinant library or the genome of a cell, using standard cloning technologies such as PCR, or by synthesis.
In the context of the invention, the term "oligonucleotide" designates a polynucleotide of which, preferably, the size does not exceed 100 nucleotides (or bases), or even 95, 80, 75, 70, 65, 60, 55 or even 50 nucleotides (or bases).
Within the meaning of the invention, the terms "peptide", "polypeptide" and "protein" are used interchangeably and refer to a compound consisting of amino acid residues covalently linked by peptide bonds. A protein contains by definition at least two amino acids, without limitation as to the maximum number of amino acids. The polypeptides interchangeably include several peptides and / or proteins, which themselves comprise two or more amino acids connected to each other by peptide bonds. As used herein, the term refers to both short chains, which are also commonly referred to in the art as peptides, oligopeptides and oligomers for example, and longer chains, which are generally designated in the art as proteins, of which there are many types. "Polypeptides" include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, polypeptide variants, modified polypeptides, derivatives, analogs, fusion proteins, among others . The polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof.
The terms "identical" or "homologous" refers to the sequence similarity or sequence identity between two polypeptides or between two nucleic acid molecules. When a position in each of the two compared sequences is occupied by the same amino acid base or subunit monomer (for example, when a position in each of the two DNA molecules is occupied by an adenine), then the molecules are homologous or identical for this position. The percentage of identity between two sequences is a function of the number of corresponding positions shared by the two sequences, and corresponds to this number divided by the number of positions compared and multiplied by 100. For example, if 6 out of 10 positions in two sequences matched are identical, so the two sequences are 60% identical. In general, the comparison is made by aligning the two sequences so as to give maximum homology / identity.
A "vector" within the meaning of the invention is a molecular construct which comprises an isolated nucleic acid and which can be used to deliver the isolated nucleic acid into a cell. Many vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term "vector" designates, for example, an autonomously replicating plasmid or a virus. The term should also be understood to include non-plasmid or non-viral compounds that facilitate the transfer of nucleic acids into cells, such as, for example, polylysine compounds, liposomes, and the like. Examples of viral vectors include adenoviral vectors, adeno-associated viral vectors, and retroviral vectors.
The term "expression vector" denotes a vector comprising a recombinant polynucleotide, which comprises expression control sequences operably linked to a nucleotide sequence to be expressed. An expression vector comprises, in particular, expression elements acting in cis; other elements for expression that may be provided by the host cell or by an in vitro expression system. Expression vectors within the meaning of the invention include all those known in the art, such as cosmids, plasmids (for example naked or contained in liposomes) and viruses (for example lentiviruses, retroviruses, adenovirus and adeno-associated viruses) that incorporate the recombinant polynucleotide.
The term "promoter" as used herein is defined as a DNA sequence recognized by the cell synthesis machinery, or introduced synthetic machinery, necessary to initiate the specific transcription of a polynucleotide sequence.
Within the meaning of the invention, the term "promoter / regulatory sequence" denotes a nucleic acid sequence necessary for the expression of the polynucleotide operably linked to the promoter / regulatory sequence. In some cases, this sequence may be the promoter base sequence, while in other cases this sequence may also include an activator sequence and other regulatory elements useful for polynucleotide expression. The promoter / regulatory sequence may be, for example, a sequence allowing the expression of the polynucleotide which is specific for a tissue, that is to say preferably occurring in this tissue.
Within the meaning of the invention, a "constitutive" promoter is a nucleotide sequence which, when operably linked to a polynucleotide, leads to expression of the polynucleotide in most or all physiological conditions of the cell.
Within the meaning of the invention, an "inducible" promoter is a nucleotide sequence which, when operably linked to a polynucleotide, leads to expression of the polynucleotide only when a promoter inducer is present in the cell.
A "tissue-specific" promoter is a nucleotide sequence which, when operably linked to a polynucleotide, leads to expression of the polynucleotide in a cell preferentially if the cell is a cell of the tissue type corresponding to the promoter. .
Within the meaning of the invention, the term "abnormal" when used in reference to organisms, tissues, cells or components thereof, refers to those organisms, tissues, cells or components thereof. ci which differ from at least one observable or detectable characteristic (eg age, treatment, time of day, etc.) of the expected characteristic in so-called "normal" organisms, tissues, cells or components.
The terms "patient", "subject", "individual" and synonyms are used in the context of the invention interchangeably and refer to an animal, preferably a mammal. In some non-limiting embodiments, the animal is a human. It can also be a mouse, a rat, a pig, a dog or a non-human primate (NHP), such as the macaque.
For the purposes of the invention, a "disease" or "pathology" is a state of health of an animal in which the homeostasis thereof is impaired, and which, if the disease is not treated, continues to deteriorate. On the other hand, within the meaning of the invention, a "disorder" is a state of health in which the animal is capable of maintaining its homeostasis, but in which the state of health of the animal is less favorable to that she would be in the absence of the disorder. Without treatment, a disorder does not necessarily result in deterioration of the animal's health status over time.
In the context of the invention, a disease or disorder is "alleviated" or "improved" if the severity of a symptom of the disease or disorder, or the frequency with which the symptom is felt by the subject, or the two, is reduced. It also includes the disappearance of the progression of the disease, that is, the cessation of the deterioration of the state of health. A disease or disorder is "cured" if the severity of a symptom of the disease or disorder, or the frequency with which such a symptom is felt by the patient, or both, is eliminated.
In the context of the invention, a "therapeutic" treatment is a treatment administered to a subject who exhibits the symptoms of a pathology, with the aim of reducing or eliminating these symptoms.
In the context of the invention, "treating a disease or disorder" means reducing the frequency or severity of at least one symptom of a disease or disorder in a subject.
Within the meaning of the invention, an "effective amount" of a compound is the amount of the compound that is sufficient to achieve a beneficial effect for the subject to which the compound is administered. The term "therapeutically effective amount" refers to an amount that is sufficient or effective to prevent or treat (in other words, delay or prevent the onset, prevent progression, inhibit, reduce, or reverse) a disease or condition. disorder, including relieving the symptoms of this disease or disorder.
DETAILED DESCRIPTION OF THE INVENTION
According to a first aspect, the present invention relates to an adeno-associated recombinant viral vector (AAVr) comprising a sequence encoding an antisense oligonucleotide (AON) directed against a segment of at least 33 bases of the +30 to +69 region of the exon 53 of the pre-messenger RNA (pre-mRNA) of dystrophin.
The AAVr vector according to the invention typically comprises 2 components: The encapsidated recombinant nucleic acid sequence, also called the "rAAV genome". This recombinant nucleic acid sequence comprises the cod coding sequence, which AON produces the therapeutic effect, in this case the jump of the exon 53 of the dystrophin pre-mRNA, when expressed in the cell / the target tissue; - The viral capsid that allows gene transfer and some tissue tropism.
According to the invention, the genome of the AAVr vector therefore comprises a sequence encoding an antisense oligonucleotide or AON. This sequence is advantageously in the form of DNA, and allows the expression of an AON capable of hybridizing with the target pre-mRNA, in this case at exon 53 of the pre-mRNA of dystrophin. .
Typically according to the invention, the antisense oligonucleotide allows the jump of exon 53 to the messenger RNA of dystrophin. It should be understood that the jump of exon 53 using ΓΑΟΝ according to the invention is carried out at the stage of splicing the premessing RNA of dystrophin. In a known manner in this technical field, ΓΑΟΝ selected targets and hybridizes with regions involved in splicing. In the presence of such an AON, splice sites "masked" by ΓΑΟΝ are not recognized by the cellular machinery so that the targeted exon is not integrated into the resulting messenger RNA and thus "skipped".
In the context of the invention, the term "dystrophin pre-messenger RNA" or "dystrophin pre-mRNA" is understood to mean the transcription product of the gene coding for the dystrophin protein, as obtained before the step of splicing.
The present invention is directed to any gene encoding a dystrophin, or any organism comprising such a gene, for which the jump of exon 53 may be of interest, namely the production of a shorter but at least partially functional protein. According to a preferred embodiment, the targeted gene is the human gene for dystrophin. The human dystrophin gene is well documented: it is 2.7 Mb in size and is composed of 79 exons. Its complete sequence is available in the databases, for example in the NCBI database under the reference Gene ID: 1756 or the Ensembl database under the reference ENSG00000198947.
Advantageously and in the context of the invention, the term "pre-messenger RNA of dystrophin" the pre-mRNA of dystrophin of human origin, in other words the pre-mRNA of human dystrophin.
The sequences of the pre-mRNA of human dystrophin are well known and are particularly accessible thanks to the references indicated above in relation to the entire gene.
More specifically, the present invention relates to exon 53 of the pre-mRNA of human dystrophin. In known manner, it consists of 212 bases or nucleotides and has the sequence SEQ ID NO: 1 below: ttgaaagaat tcagaatcag tgggatgaag tacaagaaca ccttcagaac cggaggcaac agttgaatga aatgttaaag gattcaacac aatggctgga agctaaggaa gaagctgagc aggtcttagg acaggccaga gccaagcttg agtcatggaa ggagggtccc tatacagtag atgcaatcca aaagaaaatc acagaaacca ag
For the purposes of the invention, the regions described below are identified by the position of the nucleotides with reference to the exon 53 sequence of the dystrophin pre-mRNA, that is to say to the sequence SEQ ID NO: 1.
In the remainder of the description, the numbering used is therefore based on the sequence SEQ ID NO: 1, it being understood that ΓΑΟΝ necessarily and by definition has a sequence complementary to that of its target. Consequently, it should be understood that the PAON coding sequence, which is included in the vector of the invention, is a sequence corresponding to the inverse complementary to the targeted region in exon 53 of the pre-mRNA of dystrophin.
According to a first feature, PAON according to the invention targets the region +30 to +69 of exon 53 of the pre-mRNA of dystrophin, namely the region of 40 bases of sequence: g tacaagaaca ccttcagaac cggaggcaac agttgaatg
Preferably, PAON is directed against a segment of at least 33 bases (or nucleotides) of said region. In other words, Pantisens hybridizes with at least 33 consecutive nucleotides of this region consisting of 40 nucleotides.
For the purposes of the invention, it is meant that an oligonucleotide hybridizes with a target sequence when said oligonucleotide and the target sequence form, under conditions of determined stringency, moderate or advantageously strong, a double-stranded pre-mRNA molecule.
The stringency conditions conventionally depend on experimental conditions such as temperature, ionic strength, and the concentration of denaturing agents (such as formamide) in the reaction medium. These conditions and their possible variations are well known to those skilled in the art. By way of example of conditions of high stringency, mention may be made in particular of hybridization and washing carried out with compositions comprising sodium chloride (0.015 M) and sodium citrate (0.0015 M), at 65-68 ° C. (See Sambrook, Fritsch & Maniatis, Molecular Cloning, A Laboratory Manual, 2nd Ed, Cold Spring Harbor Laboratory, NY 1989). Conditions of moderate stringency may correspond to hybridization and washing carried out in these same compositions, but at a lower temperature, typically between 50 and 65 ° C.
In other words, the oligonucleotide must have an identity with the target sequence sufficient to allow pairing of the two strands. This is ensured since the two sequences are identical, but can also take place in the presence of one or more (in particular 2, 3, 4 or 5) divergent nucleotides, advantageously when these are located within the sequence. In terms of identity, the oligonucleotide advantageously has at least 70%, 75%, 80%, 85% or even 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%. %, 99%, even more preferably 100% identity with the target region.
According to a particular embodiment, the AON is directed against a segment of more than 33 bases, namely 34, 35, 36, 37, 38, 39 or even 40 bases of the region ranging from +30 to +69 nucleotides of the sequence SEQ ID NO: 1. According to a preferred embodiment, the oligonucleotide hybridizes to the entire region of +30 to +69 of the sequence SEQ ID NO: 1. The term "hybridizes" 'means as defined above, that is covers the case of a perfect identity between the oligonucleotide and the target region, but also the cases where there is one or more mismatchs ).
According to another embodiment, ΓΑΟΝ can be directed against a region extending on either side of the target region. Thus, ΓΑΟΝ encoded by said sequence may hybridize with a region extending 5 'and / or 3' beyond the region +30 to +69 of exon 53, with the advantageous condition that such AON has an efficiency, in terms of the jump of exon 53, at least equal to that observed with an AON directed against a segment of more than 33 bases in the region from nucleotides +30 to +69 of sequence SEQ ID NO : 1, or even that of an AON directed against the region of nucleotides +30 to +69 of the sequence SEQ ID NO: 1.
According to the invention, the size of the sequence coding for the antisense oligonucleotide of interest is at least equal to the size of the segment targeted in exon 53, namely at least 33 nucleotides.
In the case where the targeted segment has a larger size, which may in particular vary from 34 to 40 nucleotides, the coding sequence ΓΑΟΝ according to the invention has a size at least equal, namely at least 34, 35, 36, 37, 38, 39 or even 40 bases. According to a particular embodiment, the coding sequence ΓΑΟΝ according to the invention consists of 34 bases, preferably 35 or even 36, 37, 38 or 39 bases. According to a preferred embodiment, the coding sequence ΓΑΟΝ according to the invention consists of 40 nucleotides.
According to another particular embodiment, the coding sequence ΓΑΟΝ implemented in the context of the invention has a size less than 70 bases, or even less than or equal to 65, 60, 55, 50 or even 45, 44, 43, 42 or 41 bases.
According to a particular embodiment, the sequence coding for the antisense oligonucleotide, comprised in the rAAV of the invention, comprises or consists of the sequence SEQ ID NO: 3 or SEQ ID NO: 4, advantageously SEQ ID NO: 3 .
More specifically: the sequence SEQ ID NO: 3 (which is designated in the examples "JR53" or "5902") corresponds to a sequence of 40 nucleotides encoding an AON targeting the + 30 / + 69 region of exon 53 of the pre-mRNA of dystrophin; The sequence SEQ ID NO: 4 (which is designated in the examples "N3" or "5901") corresponds to a sequence of 33 nucleotides encoding an AON targeting the + 33 / + 65 region of exon 53 of pre-mRNA dystrophin.
According to an advantageous embodiment, said oligonucleotide is directed against the entire +30 to +69 region of exon 53 of the dystrophin gene. Consequently, according to a particular embodiment, the séquence coding sequence included in the AAVr of the invention has a size of 40 bases and has the sequence SEQ ID NO: 3. Alternatively, it comprises the sequence SEQ Π) NO: 3.
Typically according to the invention, the sequence encoding the antisense oligonucleotide or AON is carried or carried by an AAVr vector. In other words, the sequence encoding the antisense oligonucleotide or AON is contained or included in the genome of rAAV.
Recombinant adeno-associated viral vectors (rAAVs) are now recognized as powerful tools for gene transfer, considered in the treatment of many diseases. AAVr vectors have a number of features that make them suitable for gene therapy, particularly the absence of pathogenicity, moderate immunogenicity, and the ability to transduce post-mitotic cells and tissues in a stable and efficient manner. The expression of a particular gene carried by an AAV vector may, in addition, be targeted in one or more cell types by appropriately selecting the serotype of AAV, the promoter and the mode of administration.
RAAVs are derived from genetic engineering modification of AAV viruses. More than 100 natural serotypes of AAVs are now known. There are many natural variants at the capsid level of AAV, which has allowed the production and use of specific AAVr with properties particularly suitable for muscular dystrophies. AAVr vectors can be generated using standard molecular biology techniques, making it possible to optimize AAV viruses for specific cellular delivery of nucleic acid molecules, to minimize immunogenicity, to adjust stability and shelf life particles, for efficient degradation, and for transport at the nucleus. As mentioned above, the use of rAAV is a common mode for delivering exogenous DNAs because of their non-toxicity, efficient DNA transfer and the ability to optimize them for particular purposes.
Among serotypes of AAVs isolated from humans or non-human primates and well characterized, human serotype 2 is the first AAV that has been used for the production of AAVr vector for gene transfer. Other AAV serotypes commonly used in the production of AAV vectors include AAV1, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 and AAV12.
The viral genome of AAVs consists of about 5000 nucleotides and comprises a gene encoding regulatory and replication (rep) proteins and a gene encoding structural proteins (cap). The sequences necessary in cis for the replication of the genome and its packaging are contained in a segment of 130 to 145 nucleotides found at each end of the genome (ITR for "inverted terminal repeat"). From these viruses, a large number of chimeric (hybrid) recombinant vectors and AAVr can also be produced and used.
AAV fragments useful for assembly into vectors include cap proteins, in particular vpl, vp2, vp3 and hypervariable regions, rep proteins, including rep 78, rep 68, rep 52 and rep 40, and coding sequences. these proteins. These fragments can be used in a wide variety of vector systems and host cells.
In the context of the production of rAAV, these fragments can be used alone, in combination with sequences and fragments of other serotypes of AAVs, in combination with elements of other AAVs or with viral sequences not derived from AAVs. Within the scope of the invention, suitable AAVs include, but are not limited to, modified AAVs comprising unnatural capsid protein. Such an artificial capsid can be generated by any suitable technique, using a selected AAV sequence (e.g. a fragment of the capsid protein vpl) in combination with heterologous sequences that can be obtained from a selected serotype of AAV. different, non-contiguous portions of the same AAV serotype, a non-AAV viral source, or a non-viral source. An artificial AAV serotype may be, without limitation, a chimeric AAV capsid, a recombinant AAV capsid, or a "humanized" AAV capsid. Such examples of AAVs, or artificial AAVs, include AAV2 / 8 (US 7,282,199), AAV2 / 5 (available from the National Institutes of Health), AAV2 / 9 (WO 2005/033321), AAV2 / 6 (US 6,156,303). ), and AAVrh8 (WO 2003/042397), among others. According to one embodiment, the vectors that are useful in the compositions and methods of the invention contain, at a minimum, sequences coding for a capsid of a selected AAV serotype, for example an AAV8 capsid, or a fragment thereof. . According to another embodiment, useful vectors contain at least sequences encoding a rep protein of a selected AAV serotype, for example a rep AAV8 protein, or a fragment thereof. Optionally, such vectors contain both cap and AAV rep proteins. In vectors in which there is both rep and cap, the rep and cap protein sequences of AAVs may originate from the same AAV, for example all from an AAV8. Alternatively, vectors may be used in which the rep sequences emanate from an AAV serotype different from that from which the cap sequences emanate. In one embodiment, the rep and cap sequences are expressed from separate sources (e.g., separate vectors, or a host cell and a vector). In another embodiment, these rep sequences are fused in phase to the cap sequences of a different serotype AAV to form a chimeric AAVr vector such as AAV2 / 8 (US 7,282,199). From the AAVs, recombinant AAV genomes can be prepared, in which the genes encoding the viral proteins (rep and cap) are deleted, leaving only the two ITR repeat sequences. The production of recombinant vectors requires the multiplication and packaging of these recombinant genomes. This step is most often carried out in cultured cells that are transfected with both the recombinant genome of interest and plasmids coding for the missing rep and cap proteins (cap proteins allowing the formation of the capsid). It is possible to use a recombinant genome and rep and cap genes from identical or different serotypes. A large number of combinations are thus possible.
In the case where the serotypes are identical, indicate the only serotype corresponding to the vector. In the case where the serotypes are different, so-called hybrid AAVr vectors are obtained for which the serotypes used are indicated. By way of example, an AAVr vector of serotype 2 is included as originating from serotype 2 alone. On the other hand, a serotype 2/8 AAVr vector is a vector for which a recombinant genome derived from a serotype AAV has been used. 2, while the genes encoding the capsid proteins used correspond to those of a serotype 8 AAV.
It has been shown that the capsid of AAV viruses, and consequently rAAV vectors, is generally associated with a particular cellular or tissue tropism.
According to the invention, the AAV used is advantageously based on AAV serotype 2 (AAV2), 8 (AAV8) or 9 (AAV9). Suitably, the capsid is chosen to allow efficient or even preferential transduction of the muscle, be it skeletal, cardiac or smooth. Thus, and preferably, the AAV used is advantageously an AAV chosen from the following group: AAV2 / 1, AAV2, AAV2 / 6, AAV2 / 8, AAV2 / 9, AAV2 / 10. In a preferred manner, the vector is an AAV8 vector, still more advantageously an AAV2 / 8 vector.
As regards the AAVr vectors implemented in the context of the invention, the AAV genome can be a single-stranded (ss) or double stranded (ds) nucleic acid. or a self-complementary nucleic acid (sc for "self complementary").
The production of rAAV vectors is well known to those skilled in the art, and can be carried out by bi-transfection or tri-transfection of HEK 293 cells, by the herpes simplex viral system or by means of the baculovirus system. Advantageously, the particles are obtained by bi- or tritransfection of HEK 293 cells, or using the baculovirus system.
According to a particular embodiment, the vector according to the invention further contains or comprises a sequence encoding a modified snRNA. More specifically, the sequence encoding the antisense oligonucleotide (AON) according to the invention is introduced or inserted into the sequence coding for the snRNA. In other words and preferably, the vector of the invention comprises a sequence encoding an antisense oligonucleotide, itself included in a sequence encoding a modified snRNA. This embodiment allows the expression of an oligonucleotide comprising the modified snRNA in which the AON is integrated. As already stated, the integration of ΓΑΟΝ into a modified snRNA has the effect of stabilizing the expression of the oligonucleotide that results, and further to allow nuclear expression of these oligonucleotides.
SnRNAs (for "small nuclear RNA") are small RNAs, present in the nucleus of cells and involved in certain stages of maturation of pre-mRNAs. They are called Ul, U2, U3 ... until U13. It is well known that native snRNA comprises a specific antisense region of the pre-messenger RNA which it matures. This sequence allows hybridization to the target messenger pre-RNA. Moreover, the region encoding the native snRNA (that is to say the sequence that is actually transcribed) includes a so-called sm domain, which encodes a Sm protein binding site (for "small nuclear ribonucleoprotein"). ). This domain is essential for the activity of maturation of the snRNA pre-messenger RNA (Grimm et al., EMBO J., 1993, 12 (3): 1229-1238). The native snRNA coding region further comprises a sequence encoding a stem-loop form that has been shown to stabilize the interaction between the snRNA and the pre-mRNA to mature, thereby facilitating splicing (Sharma et al. al., GenesDev., 2014, 28 (22): 2518-2531).
In the context of the invention, the term "sequence encoding a modified snRNA" means an oligonucleotide having as a sequence the native sequence of the functional gene of the snRNA, in which the sequences involved in the initial function of the snRNA are inactivated and / or modified. , advantageously by insertion of the sequence encoding the AON according to the invention. For the purposes of the invention, the term "native sequence of the functional gene" is intended to mean that part of the endogenous gene comprising the region encoding the snRNA (that is to say the transcribed sequence), as well as the 5 'regulatory regions and 3 ', and in particular the native promoter of the snRNA.
Preferably, the coding sequence for the modified snRNA encodes a U7 type snRNA. According to this embodiment, the sequence of the Sm protein binding sites is modified so as to inactivate the maturation of the pre-messenger RNAs encoding the histones, advantageously by insertion of the coding sequence ΓΑΟΝ according to the invention.
As described in connection with the U7-type snRNA, the sequence of the Sm protein binding sites may be further modified so as to increase the nuclear concentration of snRNA, for example replaced by an optimized sequence, advantageously the smOPT sequence described by Schümperli and Pillai (Cell Mol Life Sci 60: 2560-2570, 2004).
On the other hand, and in order to facilitate the desired splicing, the coding sequence for the stem-loop form is preferably native. In other words, it is advantageously unmodified.
As already stated, the modified snRNA implemented in the context of the invention is preferably devoid of the specific native antisense sequence targeting the messenger pre-mRNA targeted by this snRNA, in this case that of the histones for the U7snRNA . Advantageously, this sequence is replaced by a sequence coding for the antisense oligonucleotide of interest, in this case targeting the region between the +30 and +69 bases of exon 53 of the pre-mRNA of dystrophin.
For the purposes of the invention, the sequence coding for the modified snRNA may also be modified so as to replace the native sequence of the snRNA promoter with the sequence of another promoter, for example the promoter sequence of another type of promoter. snRNA. By way of example and according to the invention, a "U7-type modified snRNA coding sequence" designates a U7-type snRNA coding sequence which has undergone the modifications set forth above but comprising the native U7 snRNA promoter. It is possible to replace this promoter by that of another snRNA, for example of the Ul, U2 or U3 type, or anywhere else suitable promoter for the implementation of the invention. The various promoters of the snRNAs are well known and have in particular been described by Hemadez (J Biol Chem :, 2001, 276 (29): 26733-6).
In the context of the invention and among the different types of snRNA, that of U7 type (U7snRNA), normally involved in the processing of premonitory RNAs encoding histones, is preferably used.
In this context, it has also been shown that a particular domain, called "kiss domain" allows, when it is fused to the antisense oligonucleotide carried by the snRNA, to hybridize with the stem-loop form of the snRNA . This hybridization induces a modification of the secondary structure of the modified snRNA which improves its interaction with the molecular machinery necessary for splicing. This domain has been described in particular in the application WO 2011/113889, the content of which must be considered as part of the present application. Thus, it is possible to integrate in the coding sequence of the modified snRNA according to the invention a coding sequence for the "kiss domain" as described in this document.
In practice, these different modifications can be introduced into the sequences encoding the snRNA by means of usual techniques in genetic engineering, such as PCR-directed mutagenesis. Note that snRNA sequences are highly conserved between different species. Thus, the sequence encoding the modified snRNA used in the vector of the invention can be of both human and murine origin. Preferably, the sequence coding for the modified snRNA used in the invention is of murine origin.
A typical construct according to the invention, encoding a snRNA in which is inserted the sequence encoding the AON of interest, will therefore advantageously comprise: the 5 'untranslated region of the gene encoding the U7 snRNA, including in particular the promoter, advantageously of murine origin, such as for example illustrated by nucleotides 1 to 258 of the sequence SEQ ID NO: 2; The sequence encoding AON directed against the +30 to +69 region of exon 53 of the pre-mRNA of dystrophin. By way of example, nucleotides 259 to 298 of the sequence SEQ ID NO: 2 illustrate such a sequence, which encodes an oligonucleotide of 40 bases (designated JR53 in the examples) and of sequence SEQ ID NO: 3. However, this sequence antisense can for example be replaced by the sequence SEQ ID NO: 4; The sequence of attachment of the modified Sm protein, for example the smOPT sequence, corresponding to nucleotides 299 to 309 of the sequence SEQ ID NO: 2; The coding sequence for the stem-loop form, unmodified and advantageously of murine origin, corresponding to nucleotides 310 to 340 of the sequence SEQ ID NO: 2; The 3 'untranslated region of U7 snRNA, advantageously of murine origin, such as, for example, illustrated by nucleotides 341 to 442 of the sequence SEQ ID NO: 2.
Preferably, the sequence coding for an antisense oligonucleotide of interest is integrated upstream of the sequence of attachment of the modified Sm protein, namely upstream of the smOPT sequence.
A modified snRNA as described above, advantageously of the U7 type, and incorporating an antisense oligonucleotide of interest within the meaning of the invention, may for example have the sequence SEQ ID NO: 2.
It should be noted that other sequences can be integrated in the construction described above. In particular, other sequences may be integrated into the modified snRNA carrying the coding sequence of interest, advantageously upstream or downstream of said sequence. It may in particular be envisaged the insertion of at least one sequence coding another AON of interest, directed against another region of exon 53 or allowing the jump of another exon of dystrophin whose jump also presents an interest.
The sequence encoding the modified snRNA carrying the 1 cod coding sequence of interest in the context of the invention is advantageously inserted between the 2 ITR sequences of an AAV, for example serotype 2. A corresponding construct is for example illustrated in FIG. the sequence SEQ ID NO: 10. Note that given the size of the constructions envisaged within the scope of the invention and the encapsulation capacity of the AAVs, it is possible to envisage the integration of other constructions between the two ITR sequences of the AAVr vector according to the invention: the introduction of one or more additional copies (for example from 1 to 9, advantageously from 1 to 3) of the sequence coding the construction according to the invention (snRNA in which is inserted the Γ AON coding sequence of interest), for example of sequence SEQ ID NO: 2; introducing one or more other sequences encoding a modified snRNA, carrying at least one sequence encoding another AON of interest, directed against another region of exon 53 or allowing the jump of another exon of the dystrophin whose jump is also of interest.
In other words, and in order to improve the exon skipping, the AAVr vector according to the invention may comprise several sequences coding for antisense oligonucleotides. Different embodiments are possible, which are not mutually exclusive. According to a first embodiment, the AAVr vector comprises several modified snRNAs, each of these snRNAs comprising a sequence encoding an antisense oligonucleotide. According to a second embodiment, the AAVr vector comprises a single modified snRNA, which comprises several sequences coding for one or more antisense oligonucleotides. In this embodiment, it is understood that the rAAV may comprise several sequences encoding the same antisense oligonucleotide, and / or sequences encoding different antisense oligonucleotides.
Also part of the invention is any type of isolated cell transduced by the AAVr vector described above. It is advantageously of muscle cells, in particular muscle fibers (myotubes) or muscle precursors (myoblasts). According to a particular embodiment, human embryonic cells having required the destruction of a human embryo are excluded from the scope.
Isolated muscle tissue or a non-human organism transduced by said vector is also included within the range of protection sought. Among non-human organisms, animals are preferred.
The present application describes for the first time a therapeutic potential for the claimed vector. The present invention thus also relates to pharmaceutical compositions comprising as active ingredient at least one AAVr vector as defined in the present application, as well as the use of this vector as a medicament.
In another aspect, the present invention relates to a composition, preferably a pharmaceutical or drug composition, comprising an AAVr vector as described above, and potentially other active molecules (other gene therapy products, chemical entities, peptides, proteins, ...), dedicated to the treatment of the same disease or another disease.
Thus, the present invention provides pharmaceutical compositions comprising a nucleic acid according to the invention, in this case an AAVr vector according to the invention. Such a composition comprises a therapeutically effective amount of the vector according to the invention and a pharmaceutically acceptable and inert carrier. According to a particular embodiment, the term "pharmaceutically acceptable" means approved by a federal regulatory agency or a state, or listed in the US or European pharmacopoeia, or any other pharmacopoeia recognized as eligible for use by humans and humans. animal. The term "vehicle" refers to a diluent, adjuvant, excipient or carrier with which the therapeutic agent is administered. Such pharmaceutical vehicles can be liquids, advantageously sterile, such as water and oils, including those of petroleum, animal, plant or synthetic origin, such as peanut oil, soy mineral oil, sesame oil and others. Water is a preferred vehicle when the composition is administered intravenously. Saline solutions, aqueous dextrose, glycerol solutions can also be used as liquid vehicles, especially in the case of injectable solutions. Pharmaceutically acceptable excipients include starch, glucose, lactose, sucrose, sodium stearate, glycerol monosterate, talc, sodium chloride, glycerol, propylene glycol, water, ethanol and others.
The composition, if necessary may also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions may take the form of solutions, suspensions, emulsions, sustained-release formulations, and others. Examples of pharmaceutically acceptable carriers are for example described in "Remington's Pharmaceutical Sciences" by E.W. Martin. Such compositions contain a therapeutically effective amount of the active agent, preferably in purified form, with a suitable amount of vehicle so as to obtain the appropriate administration form for the patient.
According to a preferred embodiment, the composition is formulated in accordance with the usual procedures for pharmaceutical compositions adapted for intravenous administration in humans. Typically, compositions for intravenous administration are solutions in sterile aqueous isotonic buffer. If necessary, the composition may also contain a solubilizing agent and a local anesthetic such as lidocaine to relieve pain at the injection site.
According to one embodiment, the composition according to the invention is suitable for administration in humans. The composition is preferably in liquid form, advantageously in the form of a salt composition, even more advantageously in the form of a composition containing a phosphate buffered saline (PBS) or a Ringer-Lactate solution.
The amount of the therapeutic agent according to the invention, in this case a recombinant AAV vector, which is effective for the treatment of dystrophic diseases can be determined by standard clinical protocols. In addition, in vitro and / or in vivo assays may be optionally performed to assist in the determination of optimal assay values. The precise dosage to be used in the composition may also depend on the route of administration chosen, the frequency of administration, the weight and / or age of the patient, the severity of the disease and must be decided by the practitioner in view of the particular context of each patient.
A suitable mode of administration should allow the delivery of a therapeutically effective amount of the active to the target tissues, especially to the skeletal muscles and possibly to the heart and diaphragm. In the particular context of the invention where the active is a recombinant AAV vector, the therapeutic dose is defined in terms of the amount of virus particles (vg for "viral genome") administered per kilogram (kg) of the patient.
In an adapted way, the adapted quantity must allow: - The jump of the exon 53 for at least 10% or even 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95 % or even 100% of dystrophin transcripts. This can be evaluated by any technique known to those skilled in the art, for example by RT-PCR; - the production of a truncated dystrophin (at least devoid of the part coded by exon 53) representing at least 5% or even 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or even 100% of the dystrophin normally produced in a healthy organism. This can be evaluated by any technique known to those skilled in the art, for example by western blotting.
In practice, and especially in the case of systemic administration, the composition is advantageously administered at a dose less than or equal to 1015 vg / kg, or even 1014 vg / kg. It can be between 1012 vg / kg and 1014 vg / kg, preferably between 2.1012 vg / kg and 5.1013 vg / kg. In known manner, a dose as low as possible to obtain a satisfactory result is preferred in particular to avoid problems of toxicity or immune reactions.
The available routes of administration are topical (local), enteral (general effect but delivery via the gastrointestinal tract (GI)), or parental (systemic action but delivery via routes other than the GI tract). The preferred route of administration of the composition according to the invention is the parental route and includes intramuscular administration (in muscle) and systemic administration (in the circulating system). In this context, the term "injection" (or infusion) includes intravascular, particularly intravenous (IV), and intramuscular (IM) administration. Injections are usually performed using a syringe or catheter.
According to a particular embodiment, the systemic delivery of the composition comprises the local administration of the composition at a treatment site, for example or level of a vein or artery of a weakened muscle. This administration technique, which involves local administration that produces systemic effects, generally called locoregional administration, has proved particularly suitable for the treatment of muscular pathologies. In practice, it may be an arterial or intravenous administration at the level of a limb of the patient (leg or arm), performed under pressure thanks to the installation of a tourniquet, as described for example by Zheng et al. (Mol Therapy, 2012, 20 (2): 456-461), Toromanoff et al. (Mol Therapy, 2008, 16 (7): 1291-99) and Arruda et al. (Blood, 2010, 115 (23): 4678-88).
In addition to locoregional administration, a preferred mode of administration according to the invention is systemic administration. Systemic administration allows reaching the whole body, and in particular all of the patient's muscles, including the heart and the diaphragm.
According to a preferred embodiment, systemic administration is performed via the injection of the composition into a blood vessel, namely via intravascular (intraarterial or intravenous) administration. In particular, the composition may be administered by intravenous injection into a peripheral vein. Alternatively, systemic administration may be intramuscular injection.
In a manner known to those skilled in the art, the systemic administration is carried out under the following standard conditions: a flow rate of between 1 and 10 ml / min, advantageously between 1 and 5 ml / min, for example 3 ml; / min; A total injection volume of between 1 and 10 ml, preferably equal to 5 ml of the vector preparation per kg of the patient. The volume injected should preferably not represent more than 10% of the total blood volume, preferably about 6%.
A single administration of the composition according to the invention may prove sufficient. However, several administrations under different conditions may be considered, including:
Repeated administration of the same vector by the same route of administration; Administration of the same vector at different sites, especially at the level of different members;
Administration of different recombinant vectors that may vary in their serotype or the TAON coding sequence delivered.
According to one embodiment, the presence of the AAV vector according to the invention, and the associated beneficial therapeutic effects, are observed for at least 1 month, or 3 months, or 6 months, or 1 year, or 2 years, or 5 years. or 10 years, or even throughout the life of the patient.
As already said, the patient is advantageously a human being, in particular a child, a teenager or a young adult. However, the therapeutic tool according to the invention can be adapted and useful for the treatment of other animals, in particular pigs and mice.
Such drugs are particularly intended for the treatment of dystrophic diseases. In the context of the invention, a dystrophic disease refers to a disease related to a defect in the dystrophin gene. More precisely, it is a defect for which the jump of exon 53 restores the reading frame and the production of a truncated but functional dystrophin. In connection with the invention, a truncated but functional dystrophin means a protein of size less than the native protein, in particular not including the region encoded by exon 53, but which is capable of providing at least some of the functions of the native protein, and in particular to at least partially attenuate the symptoms associated with the absence of native dystrophin, such as degeneration of the fibers, inflammation, necrosis, the replacement of the muscle with healing or adipose tissue, muscle weakness, respiratory or cardiac insufficiency, and premature death.
In a particular embodiment, the dystrophic disease is Duchenne Muscular Dystrophy (DMD or Duchenne's disease).
Particularly concerned are the forms of DMD associated with deletions of exon 52 (Δ52), exons 50 to 52 (Δ50-52), exons 49 to 52 (Δ49-52), exons 48 to 52 (Δ48 -52), exons 47 to 52 (Δ47-52), exons 46 to 52 (Δ46-52), exons 45 to 52 (Δ45-52), exons 43 to 52 (Δ43-52) and exons 10 to 52 (Δ10-52), or to a duplication of exon 53. The interest of the present invention is further illustrated with respect to Δ52 and Δ45-52 deletions.
The nature of deletions of the dystrophin gene present in a patient is readily determined by those skilled in the art, for example by sequencing or PCR.
In view of the remarkable effects observed on the restoration of dystrophin in muscle fibers with DMD, the invention also relates to the use of an AAV vector as described above or to a composition containing it for the manufacture of a drug, advantageously intended for the treatment of dystrophic diseases, in particular DMDs, in particular the forms listed above.
In other words, the present invention provides a method of treating dystrophic diseases, particularly as defined above, comprising administering to a subject such an AAV vector or a composition containing it.
EXAMPLES OF EMBODIMENTS The invention and the advantages which result therefrom will emerge more clearly from the following exemplary embodiments, in support of the appended figures. In particular, the present invention is illustrated in connection with an AAV 2/8 vectors and a U7-type murine snRNA, tested on myoblasts from patients with a deletion of exon 52 (Δ52) or exons 45-52. (Δ45-52) of the human dystrophin gene. These, however, have no limiting scope, and their teaching can be extended to other AAV vectors, other modified snRNAs and subjects with Duchenne disease resulting from other mutations.
LEGENDS OF FIGURES
Figure 1: Evaluation of the exon 53 jump of the messenger of human dystrophin after Δ45 / 52 myoblast transduction with the different rAAV8 vectors blinded. The analysis was carried out by RT-PCR nested between exons 44 to 56. Blc: PCR water control; NT: non-transduced cells.
Figure 2: Evaluation of the exon 53 jump of the messenger of human dystrophin after Δ52 myoblast transduction with the different rAAV8 vectors blinded. The analysis was carried out by RT-PCR nested between exons 51 to 54. Blc: PCR water control; NT: non-transduced cells.
Figure 3: Evaluation by RTqPCR of the level of expression of the human dystrophin messenger without exon 53 (as a function of the messenger level of the total dystrophin) after transduction of Δ45 / 52 myoblasts with the various rAAV8 vectors blinded. NT: non-transduced cells.
Figure 4: Leaping exon 53 from the pre-mRNA of human dystrophin on myoblasts DMD Δ45-52. AJ Δ45-52 myoblasts were transduced with the vectors AAV2 / 8-U7-5901 (noted 01) or 5902 (noted 02) or 5903 (noted 03) or 5907 (noted 07) or 5912 (noted 12) or 5894 ( noted 94) or 5899 (noted 99) (see Material and Methods) at an MOI of 300.10E + 3. Their effectiveness for the exon 53 leap was assessed by nested RT-PCR. The amount of total mRNA for dystrophin is evaluated by RT-PCR Dys3-9, and the expression of the 18S housekeeping gene makes it possible to evaluate the presence of mRNA. B / Δ45-52 myoblasts were transduced with AAV2 / 8-U7-5901 or 5902 or 5903 or 5907 or 5912 or 5894 or 5899 vectors (see Materials and Methods) at a MOI of 300.10E + 3. A Western blot multiplex was performed to detect the dystrophin and dysferlin proteins on the cells of healthy subjects (8220, protein extract diluted 1/5) and uninfected DMD Δ45-52 cells (Non Inf). This figure is representative of 4 independently performed experiments.
Figure 5: Leaping exon 53 from the pre-mRNA of human dystrophin on myoblasts DMD Δ52. A / Δ52 myoblasts were transduced with the vectors AAV2 / 8-U7-5901 (noted 01) or 5902 (noted 02) or 5903 (noted 03) or 5907 (noted 07) or 5912 (noted 12) or 5894 (noted 94) or 5899 (noted 99) (see Material and Methods) at a MOI of 300.10E + 3. Their efficiency for the jump of exon53 was assessed by nested RT-PCR. The amount of total mRNA for dystrophin is evaluated by RT-PCR Dys3-9, and the expression of the 18S housekeeping gene makes it possible to evaluate the presence of mRNA. B / Δ52 myoblasts were transduced with AAV2 / 8-U7-5901 or 5902 or 5903 or 5907 or 5912 or 5894 or 5899 vectors (see Materials and Methods) at a MOI of 300.10E + 3. A multiplex western blot was performed to detect dystrophin and dysferlin proteins on cells of healthy subjects (1: 5 protein extract) and uninfected DMD (Δ52) cells. This figure is representative of 4 independently performed experiments. The efficacy of recombinant AAV8s described in more detail below has been blind-tested in two parallel studies.
The first study (I) aimed to compare the effectiveness of the different antisense sequences at the level of the jump of exon 53 (evaluated by RT-PCR on mRNA of dystrophin), in qualitative and quantitative terms.
The second study (II) aimed to confirm the effectiveness of the different antisense sequences at the level of the exon 53 jump (assessed by RT-PCR on the mRNA of dystrophin) and at the level of the dystrophin protein produced. . A. Materials and Methods 1 / Antisense. vectors and plasmids
The antisense seals identified in Table 1 below were tested:
They were cloned by site-directed mutagenesis into the optimized murine U7snRNA gene and containing its own promoter. The corresponding construction with respect to ΓΑΟΝ 5902 (JR53) is illustrated in sequence SEQ Π) NO: 2.
The corresponding constructs were inserted into an expression plasmid, for example the plasmid pFBD.
As described by Ayuso et al. (Hum Gen. Ther., 2014, Nov 25 (11): 977-87), the plasmids used for the production of AAV2 / 8 vectors are: - pDP10 carrying the rep-2 and cap-8 genes and the auxiliary genes of Padenovirus E2b, E4, VARNA; and the vector plasmid carrying the corresponding ITR-2s and the transgene (constructions described above). 2 / Production of AAV2 / 8 vectors
The AAV8 vectors were produced from HEK293 cells (having integrated in their cellular genome the El A and E1B genes) cultured in adherent Cell Stack 5-tray system. The cells, grown in DMEM medium containing 10% fetal calf serum (volume / volume) as well as penicillin and streptomycin (1% v / v for each antibiotic), were transfected by the phosphate precipitation technique. Calcium of 2 plasmids (helper plasmid: pDP10 carrying the rep-2 and cap-8 genes and the helper genes of the adenovirus E2b, E4, VARNA and the vector plasmid carrying the corresponding ITR-2 and the transgene).
The medium is changed after transfection with serum-free DMEM medium. The AAVr particles are harvested after 72 hours in the supernatant and precipitated with 40% PolyEtheneGlycol plus benzonase. The particles are then purified on 2 successive gradients of CsCl. CsCl contaminations are removed by dialysis against 1X dPBS buffer. The particles are then frozen at -80 ° C in "low binding" tubes (Ayuso et al., Hum Gen. Ther., 2014, Nov 25 (11): 977-87). 3 / Titration of the vectors
Vector productions are treated with DNAse to remove contaminating free DNA and then extracted with viral nucleic acids. After extraction, the nucleic acids are diluted and the copy number of AAV viral genomes (AAV / ITR amplicon) is determined by qPCR with a linearized and standardized plasmid range.
For qPCR, the following primers and probes are used: AAV18mers.R: AG AGG AT AGT AT GGC (SEQ ID NO: 11) AAV22mers.F: CTCCATCACTAGGGGTTCCTTG (SEQ ID NO: 12) AAV MG BP: TAGTTAATGATTAACCC (SEQ ID NO: 12) ID NO: 13). 4 / Immortalized myoblast lines
Two lines of Duchenne patients were used, one with a deletion in the dystrophin gene from exons 45 to 52 (Δ45-52) and the other from exon 52 (Δ52). A third line of healthy subject myoblasts served as controls (8220). 1 / Protocol implemented in study I: 5 / Transduction of myoblasts immortalized by AAV2 / 8
The cells are seeded at 190,000 cells per well of 6-well plate and then cultured in the proliferation medium (skeletal muscle cell basal medium + skeletal muscle cell growth medium kit, Promocell Ref: C23160). After about 24 hours, the cells are transduced to the 5 and 5 μg / cell MOIs with the various AAV2 / 8 recombinant vectors U7snRNA modified blind and an AAV2 / 8 control allowing the expression of the Green Fluorescent Protein (GFP) in order to check the efficiency of the transductions.
After 3 days of culture, the cells are harvested and the cell pellets are dry-frozen at -80 ° C. The pellets are then used for purifications of DNA and RNA. 6 / Evaluation of the number of viral genomes per cell The extraction of the AAV genomes is carried out using the kit Gentra Puregene kit (Qiagen).
The number of vector DNA copies is determined using the TaqMan Real Time PCR procedure. The primers and probe are designed to amplify (i) the Inverted Terminal Repeats (ITRs) (see point 3) and (ii) the endogenous albumin gene. For each sample, the Ct values are compared with those obtained with different dilutions of a standard plasmid containing both the ITRs and the albumin gene. The final results are expressed in viral genomes by diploid genome (vg / dg for "viral genome / diploid genome").
Al.F: GCTGTCATCTCTTGTGGGCTGT (SEQ ID NO: 14)
Alb.R: ACTCATGGGAGCTGCTGGTTC (SEQ ID NO: 15)
AlbVIC.P: CCTGTCATGCCCACACAAATCTCTCC (SEQ ID NO: 16) 7 / Evaluation of exon skipping by nested RT-PCR The extraction of RNA from the dry pellet of cells is carried out with 1mL of Trizol Reagent according to the procedure of the procedure. provider (Life Technologies, Ref 15596-026). The RNAs are taken up in 30 μl of sterile water and are then treated with two successive stages of DNase in order to eliminate the usual RNA contaminations by the viral DNAs (Ambion, Ref AM1907). 500 ng of RNA are used for the reverse transcription reaction (Life Technologies kit, Ref 28025-013). During this step, negative reverse transcription tests are performed on each sample in order to verify the absence of contamination by viral DNAs.
For the detection of exon skipping, a first PCR (PCR1) with the Gotaq G2 enzyme (Promega, Ref: M7805) is performed from lpl of complementary DNA (cDNA) in a final volume of 50 μΐ with the couples of primers suitable for each cell type (see the list of primers below) for 25 cycles [95 ° C 30 seconds - 50 ° C or 58 ° C 1min-72 ° C 2min], then Ιμΐ of PCR1, in a volume of 50 μΐ total, are re-amplified (PCR2) for 30 cycles [95 ° C 30 seconds - 50 ° C or 58 ° C 1min-72 ° C 2min] with a second pair of primers internal to the product of PCR1. Analysis of the nested PCR products is performed by 1.5% agarose gel electrophoresis in buffer
Tris-acetate-EDTA. The bands corresponding to the exon skip are cut off, purified on a column, using the Nucleospin Gel Kit and PCR Clean-up (MACHEREY-NAGEL, Ref: 740609.250) and sequenced.
The pairs of primers used for the exon 53 jump are:
For the DMP line Δ52: PCR1: ex51 hDMD Fext and ex54 hDMD Rext at 50 ° C PCR2: ex51 hDMD Finished and ex54 hDMD Rint at 50 ° C For the Δ45-52 line:
PCR1 Dys43F / Dys57R at 58 ° C PCR2 Dys44F / Dys56R at 58 ° C Sequences of primers for exon 53 leap: ex51 hDMD Fext: GTTACTCTGGTGACACAACC (SEQ ID NO: 17) ex54 hDMD Rext: ATGTGGACTTTTCTGGTATC (SEQ ID NO: 18 ) ex51 hDMD Finished: ACTAGAAATGCCATCTTCCT (SEQ ID NO: 19) ex54 hDMD Rint: CAAGTCATTTGCCACATCTA (SEQ ID NO: 20)
Dys43-F: CCTGTGGAAAGGGTGAAGC (SEQ ID NO: 21)
Dys44-F: CGATTTGACAGATCTGTTGAG (SEQ ID NO: 22)
Dys56-R: TGAGAGACTTTTTCCGAAGT (SEQ ID NO: 23)
Dys57-R: AAGTTCCTGCAGAGAAAGGT (SEQ ID NO: 24)
The expected sizes for PCR2 are shown in Table 2 below.
8 / Quantification of exon 53 by quantitative PCR in line Δ45-52
Two RTqPCRs are performed to quantify the jump of exon 53. The first one is specific to the transcript no longer containing exon 53 of the Dystrophin (RTqPCR of the junction of exons 44 and 54). The second one is used to normalize by amplifying all the Dystrophin transcripts (RTqPCR of exons 4 and 5 junction). The cDNAs resulting from the reverse transcription reaction are diluted and then amplified using Premix Ex Taq kit using Taqman technology according to the supplier's recommendations (Takara, Ref RR390w) with 0.3pmol / l of each primer, and 0.25pmol / l. of the Taqman probe (see the list of primers and probes below) for 40 cycles [95 ° C 15seconds - 57 ° C 1min], To validate the efficiency of RTqPCRs and quantify transcripts, dilutions ranges of a reference plasmid containing the sequences of interest were deposited in parallel samples on the plate.
For RTqPCR Dystrophin without exon 53, the following primers and probes are used: hDys-44/54-F: CCTGAGAATTGGGAACATGCTAA (SEQ ID NO: 25) hDys-44/54-R: GCCACTGGCGGAGGTCTT (SEQ ID NO: 26) hDys-44/54-P: GGTATCTTAAGCAGTTGGC (SEQ ID NO: 27) = Taqman probe overlapping the junction of exons 44 and 54
For RTqPCR Total Dystrophin, the following primers and probes are used: hDys-4/5-F: CATGCCCTGAACAATGTCAACAAG (SEQ ID NO: 28) hDys-4/5-R: TCCATCTACGATGTCAGTACTTCCA (SEQ ID NO: 29) hDys-4 / 5-P: TTGCAGAACAATAATGTTGATTTA (SEQ ID NO: 30) = Taqman probe overlapping the junction of exons 4 and 5 II / Protocol used in the study Π: 5 / Transduction of myoblasts immortalized by AAV2 / 8
Cells are seeded at 100,000 cells per 35 mm well, then grown in the above-mentioned proliferation medium to 80% confluency. After about 24 hours, the cells are infected with the various 250,000 μg / cell recombinant AAV2 / 8 recombinant vectors in differentiation medium (serum-free IMDM with gentamycin) at 37 ° C.
After 4h to 6h, 250pL of IMDM supplemented with gentamycin is added. After 9 days of culture in differentiation medium, a sample of the culture medium of 1/10 of the volume of the well of 35 mm is taken. It will then be used for RNA purification for RT-PCR analyzes. In parallel, the cells are scraped, rinsed and centrifuged for 1 minute at 11 000 g or 5 minutes at 1500 rpm. The pellets are dry frozen at -80 ° C. The pellets are then used for DNA purification and viral genome quantification. 6 / Evaluation of the number of viral genomes per cell See point 1-6 above. 7 / Evaluation of the exon jump by nested RT-PCR
In order to carry out the nested RT-PCR, RNA is extracted on a column using the Nucleospin RNAII kit and eluted in 30 μl of water (DNAse / RNAse free). 500 ng of RNA are used for the reverse transcription reaction (Superscript II Life Technologies kit, Ref 18064-014).
For the detection of exon skipping, a 1st PCR is performed on 2μ1 of cDNA in a volume of 20 μΐ total with the appropriate primer pairs for each cell type (see list below) for 30 cycles [95 ° C 30 "- 56 ° C 72- 72 ° C 2 '], then 3μ1 of the PCR1, in a volume of 30 μΐ total, are amplified for 25 cycles with a second pair of primers internal to the product of PCR1. Analysis of the 18S and PO RNAs, 1 single PCR is carried out The analysis of the nested PCR products is carried out by 1.8% agarose gel electrophoresis in Tris-acetate-EDTA buffer. Exon are cut, purified on a column, using the Nucleospin Gel Kit and PCR Clean-up (MACHEREY-NAGEL, Ref: 740609.250) and sequenced (by GATC).
The pairs of primers used for the exon 53 jump are:
For myoblasts controls wt (8220) and DMP Δ52:
PCR1: Dys49F / Dys57R PCR2: Dys50F / Dys56R (human dystrophin)
For myoblasts Δ45-52:
PCR1 Dys43F / Dys57R PCR2 Dys44F / Dys56R (human dystrophin) Sequences of 5 '-> 3' primers for exon 53:
Dys43-F: CCTGTGGAAAGGGTGAAGC (SEQ ID NO: 21)
Dys44-F: CGATTTGACAGATCTGTTGAG (SEQ ID NO: 22)
Dys49-F: CAACCGGATGTGGAAGAGAT (SEQ ID NO: 31)
Dys50-F: CTCTGAGTGGAAGGCGGTAA (SEQ ID NO: 32)
Dys56-R: TGAGAGACTTTTTCCGAA-GT (SEQ ID NO: 23)
Dys57-R: AAGTTCCTGCAGAGAAAG-GT (SEQ ID NO: 24) Sequences of other primers for 18S amplification, PO and total human dystrophin: PO -F: GGCGAGCTGGAAGTGCAACT (SEQ ID NO: 33) PO-R: CCATCAGCACCACAGCCTTC (SEQ ID NO: 34) 18S-F: TCAAGAACGAAAGTCGGAGGTTCG (SEQ ID NO: 35) 18S-R: TTATGCTCAATCTCGGGTGGCTG (SEQ ID NO: 36)
Dys3-F: GAGAACCTCTTCAGTGACCTAC (SEQ ID NO: 37)
Dys9-R: GAGGTGGTGACATAAGCAGC (SEQ ID NO: 38)
The primers used for each cell type and the expected sizes are shown in Table 3 below.
8 / Evaluation of the restoration of dvstrophin expression by Western blot multiplex
The proteins are extracted from the transduced and differentiated cells for 9 days (see section 5) in a buffer containing 125 mM sucrose, 5 mM Tris-HCl pH 6.4, 6% XT-Tricine Migration Buffer (Bio-Rad ), 10% SDS, 10% Glycerol, 5% 13-mercaptoethanol and antiproteases. The samples are denatured for 5 minutes at 95 ° C and then pre-treated with the Compat-AbleTM Protein Assay Preparation Reagent Set Kit (Thermo Scientific Pierce). The protein concentration is determined by the BCA Protein Assay Kit (Thermo Scientific Pierce). 75 μg of proteins are deposited on a pre-cast Criterion XT Tris-Acetate gel (Bio-Rad). Dystrophin was detected by hybridization of the membrane with the NCL-DYS1 monoclonal primary antibody (Novocastra) diluted 1:50 followed by incubation with the sheep anti-mouse secondary antibody (HRP), diluted 1: 15,000. The proteins are revealed by the West Pico Chemiluminescent Substrate SuperSignal Kit (Thermo Scientific Pierce). B. Results and discussion
A double-blind study was conducted with the candidate antisense sequences, inserted into the optimized murine U7snRNA gene and containing its own promoter, carried by the AAV2 / 8, on two immortalized human myoblast lines, Δ45-52 and Δ52 respectively.
The tested vectors and their title are indicated in Table 4 below:
1 / Results of the study I:
These vectors were tested at a MOI of le5 and 5e5 vg / cell in blind proliferation condition by two manipulators. The efficiency of the transductions is estimated by flow cytometry and is between 68% to 96% transduced cells.
As shown in Table 5 below, the quantification by qPCR of the viral genomes per cell demonstrates the homogeneity of transduction of the different vectors:
FIGS. 1 to 3 present the results of the evaluation of the efficacy of the constructs after transduction of the DMD myoblasts Δ45-52 and Δ52 respectively: FIGS. 1 and 2 make it possible to assess the jump of the exon 53 by RT-PCR nested on both lines and Figure 3 shows the quantification of this jump by RTqPCR on line Δ45-52. II / Results of the study II:
These vectors were tested at a MOI of 300.E + 3. The transduced cells were differentiated for 9 days in order to obtain the differentiation conditions allowing the demonstration of a restoration of the dystrophin protein in the corrected cells (see Material and Methods).
Figures 4 and 5 show the results of the evaluation of the efficacy of the constructs after DMD Δ45-52 and Δ52 myoblast transduction respectively.
FIGS. 4A and 5A show the jump of exon 53 by nested RT-PCR and FIGS. 4B and 5B show the results of the study of the expression of the protein dystrophin by western blot. CONCLUSIONS:
It emerges from these two independent and quite consistent studies, that the results of the efficiency of the exon skipping are identical for the two DMD lines, namely an efficiency in the following order: 5902> 5901 = 5903. Similarly, on both myoblast lineages, the construct that carries ΓΑΟΝ 5902 is the most effective for restoring dystrophin expression.
The antisense sequences cloned in U7 and vectorized with AAV2 / 8, in particular the sequences designated JR53 (SEQ ID NO: 3) and N3 (SEQ ID NO: 4), are all more effective than the Dtex53 sequence according to the prior art ( 5912).

权利要求:
Claims (12)
[1" id="c-fr-0001]
A recombinant adeno-associated viral vector (rAAV) comprising a sequence encoding an antisense oligonucleotide (AON) directed against a segment of at least 33 bases of the +30 to +69 region of exon 53 of the pre-RNA. messenger (pre-mRNA) of dystrophin, advantageously of human origin.
[2" id="c-fr-0002]
2- AAVr vector according to claim 1 characterized in that the AON allows the jump of the exon 53 on the pre-mRNA of dystrophin.
[3" id="c-fr-0003]
3- AAVr vector according to claim 1 or 2 characterized in that the sequence codes an AON directed against a segment of at least 34, 35, 36, 37, 38, or 39, preferably 40 bases of the region +30 to +69 of exon 53 of pre-mRNA for dystrophin.
[4" id="c-fr-0004]
4- AAVr vector according to one of claims 1 to 3 characterized in that the sequence encoding the AON comprises or consists of the sequence SEQ ID NO: 3.
[5" id="c-fr-0005]
5-vector AAVr according to one of claims 1 to 4 characterized in that the sequence encoding the AON has a size less than 70 bases, preferably less than or equal to 50 bases.
[6" id="c-fr-0006]
Vector AAVr according to one of claims 1 to 5 characterized in that the coding sequence ΓΑΟΝ is included in a sequence encoding a modified snRNA.
[7" id="c-fr-0007]
7- AAVr vector according to claim 6 characterized in that the modified snRNA is of U7 type (U7snRNA), preferably of murine origin.
[8" id="c-fr-0008]
8- AAVr vector according to claim 7 characterized in that it comprises the sequence SEQ ID NO: 2.
[9" id="c-fr-0009]
9- AAVr vector according to one of the preceding claims, characterized in that the vector is chosen from the following group: AAV2 / 1, AAV2, AAV2 / 6, AAV2 / 8, AAV2 / 9, AAV2 / 10, AAV8 and AAV9, advantageously an AAV2 / 8 vector.
[10" id="c-fr-0010]
10- A pharmaceutical composition comprising an AAVr vector according to one of claims 1 to 9.
[11" id="c-fr-0011]
11- AAVr vector according to one of claims 1 to 9 for use as a medicament.
[12" id="c-fr-0012]
12- AAVr vector according to one of claims 1 to 9 or composition according to claim 10 for use in the treatment of Duchenne muscular dystrophy (DMD).

类似技术:

---

公开号 | 公开日 | 专利标题

---

EP1778297B1|2009-04-22|Adeno-associated viral vector for exon skipping in a gene encoding a dispensable-domain protein

---

EP3404106B1|2021-06-09|Selective gene therapy expression system

---

JP5894543B2|2016-03-30|Modified U7 snRNA for the treatment of neuromuscular disease

---

EP3387130B1|2020-11-11|Efficient gene therapy tools for exon 53 skipping of the dystrophin gene

---

EP3292138B1|2021-09-29|Production of large-sized microdystrophins in an aav-based vector configuration

---

EP2776568B1|2017-10-18|Inducible expression cassette, and uses thereof

---

EP2173765A2|2010-04-14|Adeno-associated viral vectors for the expression of dysferlin

---

AU2020261051A1|2021-11-04|Compositions useful in treatment of Rett syndrome

---

WO2021113390A1|2021-06-10|Compositions for treatment of diseases

---

Pichavant2010|Thérapie génique de la dystrophie musculaire de duchenne: utilisation de transgènes de la dystrophine chez le modèle canin

同族专利:

---

公开号 | 公开日

---

EP3387130A1|2018-10-17|

---

DK3387130T3|2020-12-07|

---

HK1255100A1|2019-08-02|

---

PT3387130T|2020-11-20|

---

CN108368508A|2018-08-03|

---

JP6878433B2|2021-05-26|

---

US20180362980A1|2018-12-20|

---

CA3006515A1|2017-06-15|

---

JP2019502376A|2019-01-31|

---

ES2845214T3|2021-07-26|

---

EP3387130B1|2020-11-11|

---

WO2017098187A1|2017-06-15|

---

FR3044926B1|2020-01-31|

---

US10752898B2|2020-08-25|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

US7282199B2|2001-12-17|2007-10-16|The Trustees Of The University Of Pennsylvania|Adeno-associated virus serotype 8 sequences, vectors containing same, and uses therefor|

---

WO2006021724A2|2004-08-17|2006-03-02|Genethon|Adeno-associated viral vector for exon skipping in a gene encoding a dispensable-domain protein|

---

WO2011057350A1|2009-11-12|2011-05-19|The University Of Western Australia|Antisense molecules and methods for treating pathologies|

---

US20140315977A1|2013-03-14|2014-10-23|Sarepta Therapeutics, Inc.|Exon skipping compositions for treating muscular dystrophy|

---

US6156303A|1997-06-11|2000-12-05|University Of Washington|Adeno-associated virus isolates and AAV vectors derived therefrom|

---

KR101015854B1|2001-11-13|2011-02-23|더 트러스티스 오브 더 유니버시티 오브 펜실바니아|A method of detecting and/or identifying adeno-associated virusaav sequences and isolating novel sequences identified thereby|

---

CA2524255C|2003-03-21|2014-02-11|Academisch Ziekenhuis Leiden|Modulation of exon recognition in pre-mrna by interfering with the secondary rna structure|

---

CN102174574B|2003-09-30|2016-08-03|宾夕法尼亚大学托管会|Adeno associated virus is evolved, sequence, carrier containing these sequences and their application|

---

PT1766010E|2004-06-28|2011-05-25|Univ Western Australia|Antisense oligonucleotides for inducing exon skipping and methods of use thereof|

---

US8084601B2|2008-09-11|2011-12-27|Royal Holloway And Bedford New College Royal Holloway, University Of London|Oligomers|

---

WO2011113889A1|2010-03-17|2011-09-22|Association Institut De Myologie|Modified u7 snrnas for treatment of neuromuscular diseases|

---

TWI541024B|2010-09-01|2016-07-11|日本新藥股份有限公司|Antisense nucleic acid|

---

CN110257379A|2012-07-03|2019-09-20|马林生物科技有限公司|For treating the oligonucleotides of muscular dystrophy patient|

---

MX2015008035A|2012-12-20|2016-03-17|Sarepta Therapeutics Inc|Improved exon skipping compositions for treating muscular dystrophy.|

---

AU2015286663B2|2014-07-10|2021-09-23|Stichting Radboud Universitair Medisch Centrum|Antisense oligonucleotides for the treatment of usher syndrome type 2|EP3744333A4|2018-01-25|2021-11-03|Osaka University|Medicinal composition for treating diseases associated with increase in expression level of periostin or change in splicing variant thereof|

---

US11168141B2|2018-08-02|2021-11-09|Dyne Therapeutics, Inc.|Muscle targeting complexes and uses thereof for treating dystrophinopathies|

---

WO2021089736A1|2019-11-06|2021-05-14|Association Institut De Myologie|Combined therapy for muscular diseases|

法律状态:
2016-12-23| PLFP| Fee payment|Year of fee payment: 2 |

---

2017-06-16| PLSC| Publication of the preliminary search report|Effective date: 20170616 |

---

2017-12-23| PLFP| Fee payment|Year of fee payment: 3 |

---

2018-12-21| PLFP| Fee payment|Year of fee payment: 4 |

---

2019-12-27| PLFP| Fee payment|Year of fee payment: 5 |

---

2020-12-29| PLFP| Fee payment|Year of fee payment: 6 |

---

2021-12-24| PLFP| Fee payment|Year of fee payment: 7 |

优先权:

---

申请号 | 申请日 | 专利标题

---

FR1562036|2015-12-09|

---

FR1562036A|FR3044926B1|2015-12-09|2015-12-09|EFFICIENT GENE THERAPY TOOLS FOR JUMPING DYSTROPHIN EXON 53|FR1562036A| FR3044926B1|2015-12-09|2015-12-09|EFFICIENT GENE THERAPY TOOLS FOR JUMPING DYSTROPHIN EXON 53|

---

ES16825816T| ES2845214T3|2015-12-09|2016-12-09|Effective gene therapy tools for dystrophin exon 53 skipping|

---

US16/060,396| US10752898B2|2015-12-09|2016-12-09|Effective gene therapy tools for dystrophin exon 53 skipping|

---

DK16825816.8T| DK3387130T3|2015-12-09|2016-12-09|Effective gene therapy tools for shipping exon 53 in the dystrophy gene|

---

PCT/FR2016/053312| WO2017098187A1|2015-12-09|2016-12-09|Effective gene therapy tools for dystrophin exon 53 skipping|

---

EP16825816.8A| EP3387130B1|2015-12-09|2016-12-09|Efficient gene therapy tools for exon 53 skipping of the dystrophin gene|

---

CA3006515A| CA3006515A1|2015-12-09|2016-12-09|Effective gene therapy tools for dystrophin exon 53 skipping|

---

CN201680072229.3A| CN108368508A|2015-12-09|2016-12-09|The effective gene treatment tool skipped for dystrophin exon 53|

---

JP2018530093A| JP6878433B2|2015-12-09|2016-12-09|Dystrophin Exon 53 Effective Gene Therapy Tool for Skipping|

---

PT168258168T| PT3387130T|2015-12-09|2016-12-09|Effective gene therapy tools for dystrophin exon 53 skipping|

---

HK18114253.3A| HK1255100A1|2015-12-09|2018-11-08|Effective gene therapy tools for dystrophin exon 53 skipping|